The Cas9 protein is the most widely used by scientists. This protein can easily be programmed to find and bind to almost any desired target sequence, simply by giving it a piece of RNA to guide it ...

CINDELA targets multiple InDel mutations produced during cancer development with CRISPR-Cas9 enzymes to only kill cancer cells. The CINDELA method was successfully applied to kill cancer cell lines, ...

The medium was refreshed after 5 hours of incubation. After two/three days T cells were incubated with RNP composed of recombinant Cas9 (IDT) and a guided RNA (gRNA TRAC: ucaggguucuggauaucugu) against ...

Conclusions We demonstrate a novel specific role for NHEJ in the formation of DMs, but not HSRs, in MTX-resistant cells, and that NHEJ may be targeted for the treatment of MTX-resistant colon cancer.